Advance Search

2013 Vol. 29, No. 2

Display Method:
论文
Association of suicidal ideation and family factors among rural elderly
CHENG Long-hui, CHEN Hui, ZHENG Ming-lang
2013, 29(2): 157-159. doi: 10.11847/zgggws2013-29-02-01
Abstract(1403) HTML (198)
Abstract:
Objective To estimate the prevalence and associated family factors of suicidal ideation among the elderly in rural area of Hubei province.Methods Randomly stratified cluster sampling was used in the study and face-to-face interviews were conducted among 2 025 respondents aged 60 years or above.Results Among the respondents,7.1% reported the experience of suicide ideation.The results showed that financial problem,family history of suicide,and suffering from domestic abuse(physical abuse,emotional abuse) were significant risk factors for suicidal ideation in the elderly population(P<0.05).Filial piety was a significant protective factor(P<0.05).Conclusion The prevalence of suicidal ideation among the elders in rural areas of Hubei province is high and family factors contribute to the risk of suicidal ideation.
Association of single nucleotide polymorphism of tryptophan hydroxylase isoform gene with depression and suicidal behavior
MA Jing-song, YANG Yan-jie, WANG Lin.et al
2013, 29(2): 160-163. doi: 10.11847/zgggws2013-29-02-02
Abstract(1102) HTML (186)
Abstract:
Objective To explore the association of single nucleotide polymorphism(SNP) analysis of a novel tryptophan hydroxylase isoform(TPH2) gene G1463A with depression and suicidal behavior.Methods We collected the specimens of peripheral blood from 300 depression patients and 292 controls in a population of northern China and extracted their genomic DNA.TPH2 gene G1463A was detected with TaqMan SNP genotyping assay and the association of polymorphisms of TPH2 gene with depression and suicidal behavior was analyzed using SPSS 17.0.Results The genotypic frequencies of the SNPs did not deviate from Hardy-Weinberg equilibrium in both case and control groups(P>0.05).Compared with the control group,significant differences of genotypes and alleles of TPH2 gene G1463A SNP were observed in patient group(38.0% vs 50.0% for A/A,0.3% vs 40.1% for T/T,61.7% vs 9.9% for A/T,68.8% vs 55.0% for allele A,and 31.2% vs 45.0% for allele T;P<0.05 for all).The genotypes of TPH2 gene G1463A in patient group were significantly associated with Hamilton Depression Rating Scale(HAMD) total score and factors(P=0.000).There were no significant associations of genotypes and alleles of TPH2 gene G1463A with suicide behavior in patient group(P>0.05).Conclusion TPH2 gene G1463A SNP significantly associates with unipolar depression,but may not associate with the susceptibility of suicidal behavior in depression patients.
Suicidal behavior and related psychosocial factors among middle school students in urban and rural areas of Changsha municipality
YAN Hu, CHEN Jin-dong
2013, 29(2): 163-166. doi: 10.11847/zgggws2013-29-02-03
Abstract(1434) HTML (205)
Abstract:
Objective To investigate prevalences of three specific suicide behaviors and related psychosocial factors among middle school students and to provide basis for suicide prevention and intervention.Methods A stratified cluster sampling survey was carried out with a self-designed questionnaire,suicidal behavior questionnaire,Adolescent Self-Rating Life Events Check List(ASLEC),Interaction Anxiousness Scale(IAS),and Self-Esteem Scale(SES) in 2 216 middle school students in Changsha city.Results In the past one year,24.2% of the students had suicide ideation,6% had made a specific plan to attempt suicide,and 2.5% actually had attempted suicide.The incidences of suicide ideation and suicide attempt in the girls were higher than those in the boys(χ2=34.814,P=0.000;χ2=5.924,P=0.015).The incidences of suicide plan and suicide attempt in the rural students were higher than those in the urban students(χ2=16.687,P=0.000;χ2=5.834,P=0.016).The incidence of suicide plan in the senior high school students was higher than that in the junior school students(χ2=8.109,P=0.004).The main risk factors for the three specific suicide behaviors included with single-parent family,family violence,negative life event,interaction anxiousness,and low self-esteem.Conclusion Suicide ideation is not rare in middle school students and specific intervention on related psychosocial risk factors should be promoted among the students.
Relationship between suicide ideation and family environment among university students
KAN Shuang-yu, ZHENG Xiao-fang
2013, 29(2): 167-168. doi: 10.11847/zgggws2013-29-02-04
Abstract(1548) HTML (233)
Abstract:
Objective To explore the relationship between suicide ideation and family environment for suicide prevention.Methods Totally 10 152 university students were investigated with University Personality Invertory(UPI) and Family Environment Scale-Chinese Version(FES-CV).Results The incidence rate of suicide ideation was 2.59% in the students.The scores of suicide ideation group were lower than those of the control group in cohesion(6.60?2.138 vs 7.09?1.938),emotional expression(5.20?1.782 vs 5.55?1.658),success(5.45?1.507 vs 5.73?1.435),and sense of organization(5.11?1.596 vs 5.51?1.769),but higher in contradictory(3.40?1.846 vs 3.06?2.049),knowledge(4.05?1.707 vs 3.59?1.901),and control(3.81?1.614 vs 3.49?1.966).There were significantly inverse correlations between suicide ideation and cohesion,emotional expression,success,and sense of organization(r=-0.120,-0.101,-0.093,and -0.115),but positive correlations between suicide ideation and contradictory,knowledge,and control(r=0.085,0.123,and 0.088).Step regression analyses showed that knowledge,sense of organization,and emotional expression could explain 4.0% of the total variation.Conclusion The family environment is an important influence factor of suicide ideation among university students.
Associations of genetic polymorphisms of GSTP1 and CYP1A1 with susceptibility to lung cancer
LÜ Xiao-li, CHANG Fu-hou, YIN Qin.et al
2013, 29(2): 169-172. doi: 10.11847/zgggws2013-29-02-05
Abstract(1310) HTML (213)
Abstract:
Objective To explore the susceptibility of lung cancer in relation to CYP1A1 Exon7 and GSTP1 genetic polymorphisms.Methods CYP1A1 Exon7 and GSTP1 genetic polymorphisms were determined by allele specific amplification(ASA) in 116 lung cancer patients and 216 healthy controls.Results The individuals who carried with CYP1A1 Exon 7 mutant heterozygote and homozygote had a high risk of lung cancer.However,the GSTP1 mutant heterozygote and homozygote were protective factors of lung cancer.The susceptibility to lung cancer associated with CYP1A1 Exon 7 and GSTP1 was not observed.The combined CYP1A1 mutant genotype and smoking were found to be significant risk factors of lung cancer,but not for GSTP1.Conclusion The polymorphisms of CYP1A1 Exon 7 mutant genotype maybe are the suspicious risk factors for lung cancer.The polymorphisms of GSTP1 mutant genotype might reduce the risk of lung cancer.Smoking is a susceptibility factor of lung cancer.There may be no association of CYP1A1 and GSTP1 with susceptibility to lung cancer.The combination of CYP1A1 Exon 7 mutant genotype and smoking could increase the risk of lung cancer,but the polymorphisms of GSTP1 mutant genotype and smoking may reduce the risk of lung cancer.
Susceptibility of lung cancer and polymorphisms of CYP1A1 and GSTM3 genes
LIU Chao, CHANG Fu-hou, MA Jia.et al
2013, 29(2): 172-175. doi: 10.11847/zgggws2013-29-02-06
Abstract(1022) HTML (160)
Abstract:
Objective To explore associations of polymorphisms of CYP1A1 and GSTM3 genes with susceptibility of lung cancer among Han population in Inner Mongolia.Methods Allele specific amplification and PCR-restriction fragment length polymorphism(PCR-RFLP) methods were used to analyze the genes polymorphisms of 324 Han patients without lung diseases and 174 Han lung cancer patients and the relationship between smoking and lung cancer was also analyzed simultaneously.Results There was no significant difference between lung cancer patients and the controls in CYP1A1 and GSTM3 with Chi-square test(P>0.05).Smokers had a 2.107 odds ratio(OR,95% confidence interval:1.44,3.080) of lung cancer compared to the controls.The risk was increased in the the subjects with CYP1A1 gene homozygous variant(Val/Val),with an OR of 1.576.There was a 2.5-fold increased risk of lung cancer among the subjects with CYP1A1 heterozygote(Ile/Val) and homozygous variant(Val/Val) and smoking.Conclusion Smoking is the risk factor of lung cancer.CYP1A1 heterozygote and homozygous variant were suspicious susceptibility factors of lung cancer.Smoking and CYP1A1 gene variant has synergistic effect on lung cancer susceptibility.There is no relationship of GSTM3 gene polymorphisms and lung cancer suscepitibility.
Incidences of HIV,syphilis and HSV-2 among men who have sex with men in Nanning city:a follow-up study
LAN Guang-hua, LIU Wei, LIANG Fu-xiong.et al
2013, 29(2): 175-178. doi: 10.11847/zgggws2013-29-02-07
Abstract(1272) HTML (151)
Abstract:
Objective To determine the incidences of human immunodeficiency virus(HIV),syphilis and herpes simplex virus type 2(HSV-2) among men who have sex with men(MSM) with a follow-up study,and to provide evidence for developing AIDS intervention and prevention strategies among MSM.Methods The MSM were recruited with snowball method.The subjects were followed-up and surveyed at 6th and 12th month with the questionnaires and HIV,syphilis,and HSV-2 tests.Results The incidence rate was 1.1/100 person-years(95% confidence interval[95%CI]:0-3.3) for HIV,6.8/100 person-years(95%CI:2.1-11.5) for syphilis,and 5.2/100 person-years(95%CI:1.0-9.3) for HSV-2 during the 12-month follow-up.The main reasons for the withdrawal of the follow-up was the change of phone number of the MSM.The results of multiple regression analysis showed follow-up in 6 month(P=0.000,odds ratio[OR]=12.597),living in Nanning city for one year or more(P=0.044,OR=2.831), and having sex with female in the previous 6 month(P=0.036,OR=5.359) were significantly associated with the completion of 12 month follow-up.Conclusion Compared with other cities in China,the incidence rate of HIV among MSM was low.Being followed-up in 6 month,long living time in Nanning city and having sex with female in previous 6 month are significantly associated with the completion of 12 month follow-up in the study.
Development and evaluation of juvenile campus violence questionnaire
ZHI Kui-yun, CHEN Yong-jin, XIA Wei.et al
2013, 29(2): 179-182. doi: 10.11847/zgggws2013-29-02-08
Abstract(1384) HTML (244)
Abstract:
Objective To develop a questionnaire on campus violence for adolescents and to evaluate its reliability and validity.Methods A total of 4 215 students were asked to complete the questionnaire and the data was analyzed using item analysis,exploratory factorial analysis,confirmatory factorial analysis,and the test of reliability and validity.Results The questionnaire included domains of physical violence and psychological violence.Physical violence was composed of five dimensions,including bullying,physical violence,tools violence,suicide,and sexual abuse and phychological violence was composed of four dimensions,including personal attacks,network violence,pressure building up,and verbal aggression.The total value of Cronbach α was 0.905;the values of Cronbach α for sub-questionnaires were above 0.82; the split-half reliability were 0.38-0.84 and the standard validity was significant(P<0.01),indicating the questionnaire with high validity and reliability.Conclusion The reliability and validity of the questionnaire were consistent to psychometric features,indicating the questionnaire could be used in surveys on campus violence.
Internal exposure of trihalomethanes and its influencing factors among pregnant women
CAO Wen-cheng, XU Min, LUO Yan.et al
2013, 29(2): 183-188. doi: 10.11847/zgggws2013-29-02-09
Abstract(999) HTML (144)
Abstract:
Objective To investigate the factors influencing internal exposure of trihalomethanes(THMs) among pregnant women,and to provide a basis for exposure estimates of disinfection by-products in chlorinated drinking water.Methods A total of 277 pregnant women admitted in a hospital in Wuhan city during July to December 2011 were chosen to complete a questionnaire survey.The levels of the four THMs(chloroform,bromodichloromethane,dibromochloromethane,and bromoform) in blood samples were measured by using headspace solid-phase microextraction gas chromatography.The major factors influencing the internal dose of THMs in pregnancy were analyzed with general linear regression.Results The blood level of chloroform ranged from 13.08 to 480.26 ng/L(median=70.17 ng/L) with a detection rate of 100%.The blood level of bromodichloromethane ranged from undetected level to 38.24 ng/L(median=3.30 ng/L) with a detection rate of 86.6%.The blood level of dibromochloromethane ranged from undetected level to 20.92 ng/L(median=0.48 ng/L) with a detection rate of 27.4%.The blood level of bromoform ranged from undetected level to 78.76 ng/L(median=1.41 ng/L) with a detection rate of 43.7%.The blood level of total trihalomethanes(TTHMs) ranged from 17.04 to 491.42 ng/L(median=84.86 ng/L).Both the levels of chloroform and TTHMs were positively correlated with maternal age(β=0.007,P<0.039; β=0.007,P=0.016) and inversely correlated with drinking boiled water(β=-0.170,P=0.003; β=-0.135,P=0.004).Conclusion Maternal age and boiled water may affect the internal exposure of THMs among pregnant women.
Attitude to chastity among unmarried female postgraduate students
XI Kai-guo, SUN Xue-jiang, GAO Xiao-qin
2013, 29(2): 188-190. doi: 10.11847/zgggws2013-29-02-10
Abstract(1316) HTML (219)
Abstract:
Objective To examine the attitude to chastity and its influencing factors among the unmarried female postgraduate students.Methods Subjects were 3 598 postgraduate students recruited from eastern,central,and western parts of China.We used chi-square test in data analyses.Results The results showed that only a small number(15.3%) of the students was careless about chastity and more than one third(36.7%) of the students cared about chastity;nearly a half of the students(48%) held an attitude of concrete analysis on concrete problem.The most(74.6%) of the students held an attitude of understanding and indulgence toward sex before marriage;but only a small number(18.1%) of the students would accept the sex before marriage.The students' chastity attitude differed significantly by the student's hometown,major,grade and number of romances(all P<0.05).The attitude toward sex before marriage was significantly different among the students of different grade and number of romances(P=0.000 for all).Conclusion The unmarried female postgraduate students' chastity consciousness is flagging,but most people hold a rational attitude towards it.The unmarried female postgraduate students' attitude to chastity is influenced by many factors.
Emergency management for healthcare-associated infection outbreak in medical institutions in China
XIE Duo-shuang, FU Xiang-yun, Wang Hui-fang.et al
2013, 29(2): 191-194. doi: 10.11847/zgggws2013-29-02-11
Abstract(1438) HTML (155)
Abstract:
Objective To investigate the hospitals' ability and situation of prevention and control of healthcare-associated infection(HAI) outbreak and to provide evidence for the improvement of HAI control.Methods Questionnaires were used to collect information on the organizational framework,functional realization,program and support about the prevention and control of the HAI outbreak in 121 hospitals conveniently sampled in China.The data was analyzed.Results The majority of the staff engaged in HAI control was nurses(47.97%,225/469),followed by clinical doctors(24.73%,116/469),and public health doctors(15.57%,73/469),and most of the staff had college education(44.78%,210/469).Scheme manual file for HAI emergercy was developed by 93.9%(113/121) of the hospitals but only 32.23% of the hospitals developed the plan for staff recruitment under HAI emergency.Conclusion The emergency management for HAI outbreak needs to be improved in hospitals in China.
Incidence of infertility and its influencing factors among married residents in Guangdong province
HUANG Jiang-tao, TANG Yun-ge, WANG Qi-ling.et al
2013, 29(2): 194-198. doi: 10.11847/zgggws2013-29-02-12
Abstract(1136) HTML (155)
Abstract:
Objective To dynamically analyze the infertility incidence and its influencing factors among married residents of Guangdong province.Methods With cross-sectional study method,18 893 pairs couples married in 2007 were selected from 11 counties in Guangdong by stratified cluster sampling for a questionnaire survey.Results Totally 2 516 couples were identified as infertility,with an infertility incidence of 13.3%.Couples in Pearl River Delta Region and the eastern of Guangdong had a higher infertility incidence with an odds ratio(OR) of 1.665(95% confidence interval:1.461-1.958)than those in the western Guangdong.Couples with female spouse and husband of Yao ethnic had a higher incidence than those couples with Han and Zhuang(P<0.05).The infertility probability increased with the age of the couples(95%CI:1.024-1.050 for husbands and 1.028-1.061 for wives).In the female groups,workers had a higher risk of infertility (OR=1.277,95%CI=1.077-1.513) than peasants,and smokers had a higher risk of infertility(OR= 1.627,95% CI:1.033-2.564) than non-smokers,and women with abnormal menstruation periods and amount of bleeding had a higher risk(95%CI of OR=1.374-1.935,1.233-1.554).Conclusion The incidence of infertility among married residents in Pearl River Delta region and the eastern part of Guangdong is higher than those in the western and in northern part of Guangdong province.The incidence of infertility in the minority females is higher than that in the Han.The couples'age,occupation,menstruation,and smoking habit of the females are related to the incidence of infertility.
Associations of plasma high-sensitivity C-reactive protein with traditional cardiovascular risk factors among island residents in Dalian city
YU Hui-hui, SHI Jing-pu, ZOU Sa-feng.et al
2013, 29(2): 198-201. doi: 10.11847/zgggws2013-29-02-13
Abstract(1169) HTML (133)
Abstract:
Objective To investigate the relationship between plasma high-sensitivity C-reactive protein(Hs-CRP) and traditional cardiovascular risk factors in the island residents.Methods Totally 395residents of Changhai county,Dalian city,were selected for the survey.We assessed the relationship between Hs-CRP and cardiovascular risk factors,such as age,blood pressure,smoking status and serum lipids.The data were analyzed with SPSS 16.0 statistical package.Results Plasma Hs-CRP level was 0.11 mg/l in the subjects.Plasma Hs-CRP positively correlated with age,waist circumference,body mass index,fasting blood glucose,cholesterol,triglycerides,low-density lipoprotein cholesterol,creatinine,and uric acid,with the correlation coefficients of 0.26,0.32,0.30,0.18,0.28,0.21,0.29,0.11,0.21,and 0.21,respectively.The high-density lipoprotein cholesterol and Hs-CRP showed a inverse correlation.In multiple regression analyses,fasting blood glucose,body mass index,age,high-density lipoprotein cholesterol,serum cholesterol,and smoking showed independent correlation with plasma Hs-CRP.Conclusion Hs-CRP level is affected by body mass index,age,fasting blood glucose,and high-density lipoprotein cholesterol and smoking status in the island residents.Weight control,reducing obesity could maintain the serum Hs-CRP within the normal level.
Self-rated health condition and its influencing factors among university students in Guiyang city
LIU Hai-yan, LONG Hong, WEN Bo
2013, 29(2): 202-206. doi: 10.11847/zgggws2013-29-02-14
Abstract(1233) HTML (176)
Abstract:
Objective To study self-rated health condition and its influencing factors among university students in Guiyang city.Methods With stratified sampling,a survey was conducted among 2 126 university students with Self-Rated Health Measurement Scale Version 1.0(SRHMS V1.0) and a self-developed questionnaire.Multiple linear regression was performed to analyze related factors of self-rated health condition.Results The average score of SRHMS was 73.37±9.50.The score for physical health dimension was the highest(80.52±9.41) and the lowest for mental health dimesion(65.23±14.05).There was no significant difference between the male and the female in the SRHMS score,but significant differences were found for the scores of physical health and mental health(P<0.05).Factors influencing the self-rated health condition in the students included worry about self-health constantly(β'=0.205),not paying attention to self-health(β'=0.167),not getting along with family members(β'=0.130),without regularl physical excercise(β'=0.127),having bad relationship with classmates(β'=0.102),strain relation between father and mother(β'=0.099),having a difficult economic condition in the family(β'=0.092),having rocky relationship with teacher(β'=0.091),study stress (β'=0.061),and debt burden(β'=0.044).Conclusion The health condition is not good in university students of Guiyang city and comprehensive measures for its influencing factors should be taken to improve their health.
2013, 29(2): 206-207. doi: 10.11847/zgggws2013-29-02-15
Abstract(1193) HTML (166)
Abstract:
High-density expression of a phagemid for AFB1 mimotope
XU Ling, HUANG Feng-dan, PENG Si-lu.et al
2013, 29(2): 208-210. doi: 10.11847/zgggws2013-29-02-16
Abstract(1062) HTML (176)
Abstract:
Objective To construct a phagemid for aflatoxin B1(AFB1) mimotope with the characteristics of high-density expression and a completely exposed N terminal,and to provide a method for preparing an alternative to AFB1 artificial antigen.Methods We constructed a phasemid expressing AFB1 mimotope and enterokinase site;the expression of the phasemid was induced by isopropyl-β-d-thiogalactopyranoside(IPTG).After protein cleavaged by enterokinase,an antibody of AFB1 was used in enzyme-linked immunosorbent assay(ELISA) to detect the reactionogenicity of the mimotope.Results The results of plasmid restriction endonuclease cleavage,PCR amplification and sequencing were in good accordance with the synthetic sequence;the target sequence GACGACGACGACAAGCATCCTAGTGATCCGCGTCATGGG was inserted and the mimotope cleavaged by enterokinase could be recognized by the antibody of AFB1,with an absorbance value of up to 2.112.Conclusion A phasemid expressing AFB1 mimotope exposed to the amino terminal of pⅧ after enterokinase cleavage was successfully constructed.
Cloning and analysis of cyclophilin-RNA interacting protein gene of Cryptosporidium parvum
WANG Sui-xiang, JING Chun-xia, CHEN Chuan.et al
2013, 29(2): 211-214. doi: 10.11847/zgggws2013-29-02-17
Abstract(1130) HTML (171)
Abstract:
Objective To obtain nucleotide sequences of cyclophilin-RNA interacting protein(CRIP) of Crygptosporidium parvum(C.parvum) Nanjing(NJ) strain by cloning and to analyze the difference in CRIP gene sequence between NJ strain and other strains.Methods According to known CRIP C.parvum gene sequences in GenBank,we designed and synthesized two pairs of primers to amplify the CRIP genes from the C.parvum NJ strain by nested PCR technique and cloned it into the pMD18-T vectors.Then the recombinant plasmids were sequenced by PCR and double enzyme digest method.We used bioinformatics methods to find out the homologies of the CRIP gene between C.parvum NJ strain and other strains.Results CRIP specific gene sequences were amplified by nested PCR and the correct recombinant plasmids were identified by PCR and double enzyme digest method.The results of nucleotide sequencing showed that the amplified sequence was 1 119 bp and the CRIP gene of the C.parvum NJ strain was 909 bp encoding 302 amino acids.The sequence analysis showed that there was a 98% homology in amino acids between NJ strain and the Iowa II strain abroad.Conclusion The CRIP gene of C.parvum NJ strain was cloned successfully.
Effect of terror stress of adult female rats on spatial learning and Wemory abilities in neonatal offspring
YANG Li-ping, YUAN Fu-ning, LI Xin-min.et al
2013, 29(2): 214-216. doi: 10.11847/zgggws2013-29-02-18
Abstract(1282) HTML (129) PDF 942KB(50)
Abstract:
Objective To explore the effect of terror stress of pre-pregnant rats on the spatial learning and memory abilities of neonatal offspring.Methods The terror stress model of rats was established according to the method of watching other rats shocked by electricity,and the place navigation and probe trial testing of Morris water maze task were performed to assess the spatial learning and memory abilities of the offspring at the age of 1 month.Results In place navigation test for 4 days,the average latency time was 89.5±27.2 s,70.7±40.0 s,57.4±38.3 s,and 55.5±35.9 s in the model group,while it was 47.7±16.7 s,39.8±20.6 s,30.9±18.9 s,and 26.6±13.3 s in the control group,respectively.Compared with the control group,the mean escape latency was prolonged in the model group,with significant difference(P<0.05).Compared with those in the control group,the neonatal offsprings in the model group chose non-effective strategies more frequently,with significant difference(χ2=5.104,P=0.024).In probe trial testing,compared with the control group,the average speed of the model group was slower and the percent of swimming distance within the 20% rim quadrant was larger,but smaller in other quadrant(P<0.05).Conclusion Terror-stimulated adult female rats could induce decreased spatial learning and memory abilities in their offsprings.
Anti-tumor activity of immuned hemolymph extraction from Musca domestica larvae
WEI Hong, WU Jian-wei, WANG Shuo-shi.et al
2013, 29(2): 217-219. doi: 10.11847/zgggws2013-29-02-19
Abstract(1139) HTML (173) PDF 981KB(54)
Abstract:
Objective To investigate the anti-tumor effect and its mechanism of Musca domestica larvae of three age by solid phase extraction.Methods The in vitro anticancer effect of the hemolymph extraction from Musca domestica with 40% acetonitrile(ACN)in aqueous solution by solid phase extraction was studied with 3(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-terazolium bromide(MTT) assay; tumor inhibition effect of the extraction on S180 sarcoma-bearing mice was observed.Total antioxygen capability(T-AOC),superoxide dismutase(SOD),and malondialdehyde(MDA) were detected.Results At 25 μg/mL concentration,the inhibitory rate of the S180-cells proliferation was increased to 79%.The inhibitory rate of the cell proliferation was different compared with that of the control group.For low,moderate,and high dosage treatment group,the tumor inhibition rates for mice bearing S180 were 32.13%,36.23%,and 45.23%.The activity of T-AOC and SOD was higher and the content of MDA was lower in the extraction treatment group than those in the control group,with significant differences compared with those of the control group(P<0.05,P<0.01).Conclusion The hemolymph extraction from Musca domestica with 40% ACN solid phase extraction has anti-tumor effect on S180 sacoma cells both in vivo and in vitro and the effect is probably related to antioxidation of the extraction.
Increased ROS levels and mitochondria-mediated apoptosis in Chang liver cells treated with DEHP plus BaP
WANG Jian-shu, CHEN Xi, JIANG Ying.et al
2013, 29(2): 219-221. doi: 10.11847/zgggws2013-29-02-20
Abstract(1230) HTML (164) PDF 959KB(63)
Abstract:
Objective To investigate effects of di(2-ethylhexyl) phthalate(DEHP) plus benzo(a) pyrene(BaP) on Chang liver cells.Methods Chang liver cells were treated with BaP(64 μmol/L) alone or plus DEHP at the concentrations of 0,62.5,125,250,500,and 1 000 μmol/L for 24 hours.The indicators including cell viability,level of intracellular reactive oxygen species(ROS),mitochondrial membrane potential(MMP),apoptosis percentage,and the expressions of Bax,Bcl-2 and activiated caspase-3 proteins were determined.Results Decrease in cell viability in all DEHP and BaP treatment groups and increased ROS generation in all DEHP plus BaP treatment groups were found compared with those of the DEHP treated groups(P<0.05 or P<0.01 for all).The decreases in MMP(80.12±6.41%,69.92±5.56%,and 53.76±1.88%) in the DEHP treatment(≥250 μmol/L) plus BaP treatment(64 μmol/L) groups were observed compared with that of the BaP treatment group(165.93±5.09%,P<0.01).The increases in percentage of apoptotic Chang liver cells in the DEHP plus BaP treatment groups(7.73±1.91%,11.00±3.04%,and 14.20±3.96%) were observed compared with that of the BaP treament group(1.55±0.21%,P<0.01).Furthermore,in the DEHP plus BaP treatment groups,the high active caspase-3 expression and high Bax/Bcl-2 ratio were observed.Conclusion The findings suggest that the co-treatment of DEHP plus BaP induces the reduction of cell viability and the ROS generation and mediate cell apoptosis,which associates with high Bax/Bcl-2 ratio and active caspase-3 expression.
Long-term noise exposure causes abnormality of NMDAR2B expression and tau hyperphosphorylation and induction of apoptosis in rat hippocampus
ZHU Li-xing, CUI Bo, WU Ming-quan.et al
2013, 29(2): 222-225. doi: 10.11847/zgggws2013-29-02-21
Abstract(1045) HTML (141) PDF 1249KB(59)
Abstract:
Objective To explore the effects and mechanism of long-term noise exposure on hippocampus of rats.Methods Twenty four male Sprague-Dawley(SD) rats were grouped as control and noise exposure group.Expression of N-methyl-D-aspartic acid receptor 2B subunit(NR2B) and the level of phosphorylation of tau in hippocampus were measured after chronic noise exposure(100 dB SPL white noise,4 hours per day for 30 days).To explore the possible mechanism,we also detected neuronal cell apoptosis in hippocampus by terminal deoxynucleotidyl transfease-mediated dUTP nick end-labeling(TUNEL) reactivity.Results After long-term noise exposure,the expression of NR2B in the hippocampus decreased by 41%.Meanwhile,the chronic noise exposure also caused tau hyperphosphorylation,which was twice higher than the normal,and neuronal cell apoptosis accounted for 0.5%-1% total neuronal cells in the hippocampus.Immunohistochemistry assaies confirmed that tau hyperphosphorylation was most prominent in dentate gyrus(DG) and CA1 region in the hippcampus.Conclusion Long-term noise exposure induces abnormality of neurotransmitter system and hyperpbosphorylation of tau and the adverse effects could lead to neuronal cell apoptosis and cognition impairment.
Effect of CYP1B1 on adipose tissue angiogenic factor in young obese mice
WANG Su-qing, LIU Xiao-cong, TANG Yu-meng.et al
2013, 29(2): 225-227. doi: 10.11847/zgggws2013-29-02-22
Abstract(1340) HTML (175) PDF 957KB(55)
Abstract:
Objective To explore the effect of angiogenesis on protecting young mice obesity by cytochrome(CYP1B1) deletion.Methods Sixteen male CYP1B1 deficient mice and sixteen wild type(WT) mice(C57/BL,3-week-old,right after weaning) were randomly divided into low-fat-diet(LFD,10% fat) and high-fat-diet(HFD,60% fat) groups for 11 weeks feeding.The body weight and food consumption were recorded every 3 days.The mice were sacrificed at the age of 12 weeks by decapitation and epididymal fat pad was quickly removed.Part of tissue was snap frozen in liquid nitrogen to extract total RNA for real time-PCR(RT-PCR) and another part of tissue was fixed in 4% parafomaldehyde(PFA) for sectioning and immunofluorescence detecting.Results HFD significantly downregulated WT mice CD31 expression in both transcription and translation levels,while CYP1B1 deletion rescured this inhibiton.Knockout(KO) mice exhibited higher level of angiopoietin-1 than that in WT mice on basal condition,and HFD supressed its expression in both WT and KO mice while kept angoipoietin-2 unchanged.Pro-angiogenic factor-leptin was greatly increased by HFD in mice of the two groups and CYP1B1 deletion suppressed this action.Conclusion Modulation of angiogenic factors expression and endothelial cell density by CYP1B1 deletion might play an important role in protecting the mice from HFD induced obesity,however,the detail and its mechanism need further investigation.
Function of lipid rafts in CVB3 infection on cardiocytes
WANG Huai-dong, ZHANG Ying, XU Dong-zhu.et al
2013, 29(2): 228-229. doi: 10.11847/zgggws2013-29-02-23
Abstract(1114) HTML (131)
Abstract:
Objective To explore the role of lipid rafts in coxsackievirus B3(CVB3)-infected cardiocytes.Methods Methyl-β-cyclodextrin(MβCD) was used to remove the cholesterol molecules maitaining the stability of lipid rafts on cell membrane,then the cells were infected with CVB3;western blot was adopted to detect the expression of CVB3 VP1 protein.Virus titer was determined after adding exogenous choleserol to observe inhibitive effect of MβCD on CVB3 infection.Results The damage of cell membrane lipid rafts duo to the removement of the cholesterol molecules by MβCD could inhibit the infection of CVB3 to cells and reduce the virus titer,and exogenous cholesterol could regain the inhibition of MβCD to CVB3 infection.Conclusion The lipid rafts on cardiocytes membrane plays an important role in CVB3 infection to the host cell.
Twenty-eight days feeding study on human lactoferrin expressed by cattle mammary bioreactor in mice
LIU Shan, WANG Xiao-dan, FENG Xiao-lian.et al
2013, 29(2): 230-232. doi: 10.11847/zgggws2013-29-02-24
Abstract(1111) HTML (208) PDF 938KB(51)
Abstract:
Objective To investigate sub-acute toxicity of recombinant human lactoferrin(rhLf) from cattle mammary bioreactor in mice.Methods Groups of 12 male and 12 female weaning Kuming mice were fed with AIN-93 purified diets for laboratory rodents(control group) or rhLf modified diets(treated group),in which 20 g casein/100 g AIN-93 diet was substituted for 20 g rhLf/100 g diet,for a consecutive 28-day period.Body weight and food intake were recorded weekly.At the end of the study,blood was collected for routine and biochemical blood examination and organs were dissected and weighted;histopathological examination was accomplished simutaneously.Results The final mean body weight of rhLf-treated male mice was 38.3 g?3.1 g,higher than that of the control (34.9 g?4.3 g) significantly,but there was no significant difference between two female groups(31.2 g?2.4 g in the treated and 31.2 g?1.9 g in the control).Food utilization rate,routine blood examination and biochemistry,absolute and relative weight of organs,and histopathology of organs of treated male and female mice were similar to those of the controls.Conclusion No evidence of sub toxicity was observed in the mice administered with recombinant human lactoferrin for 28 days.
Competition between Yersinia entercolitica bio-serotypes of O∶3 and O∶9 cultured in vitro
YANG Hao-shu, QIU Hai-yan, LI Ke-wei.et al
2013, 29(2): 233-235. doi: 10.11847/zgggws2013-29-02-25
Abstract(1099) HTML (166)
Abstract:
Objective To investigate whether there is a competitive relationship between different serotypes of Yersinia enteroclitica(Ye.enterocolitica strains O:3,O:9) by detecting the variation of colony-forming units(CFU) after mixture culture in vitro.Methods The Ye.enterocolitica strains of serotype O:3 and O:9 were mixed at the same quantity in 100 ml Luria-Bertani,meanwhile the two strains were cultured alone as two control groups.The oscillatory liquid were cultured at 28 ℃ and the bacterial suspension of each group was cultured in the plate for colony counting every three hours.Then the monoclonal antibody was used to identify the serotype of each colony.Results The growth peak periods of O:3 serotype in mixtured culture were significantly decreased than those cultured alone.At the culture time of 21,33,and 39 hours,the bacterial counts of the O:3 serotype strains were 4.40,5.81,and 4.79 folds higher than those cultured alone,respectively,and the growth peak perids of O:3 serotype were significantly inbibited by the O:9 serotype.However,no significant difference was observed between the O:9 serotype strain cultured alone and mixed.The multiplication rate of the two serotypes did not show any difference in the mixed and cultured alone cultivation.Conclusion The O:3 serotype did not inhibit the reproduction rate of O:9.But the O:9 serotype could inhibit the O:3 serotype.
PFGE type and serotype of Salmonella strains
LIU Gui-hua, ZHAO Wei, WANG Yan-qiu
2013, 29(2): 235-238. doi: 10.11847/zgggws2013-29-02-26
Abstract(1099) HTML (209) PDF 1141KB(55)
Abstract:
Objective To analysze serotype and pulsed-field gel electrophoresis(PFGE) type of Salmonella strains isolated from food samples collected in Jilin province and to explore molecular polymorphism of Salmonella.Methods Totally 28 Salmonella strains were isolated from raw chicken meat and Chinese salad sampled in markets and genotyped with serologic method and PFGE.The homology of the strains was analyzed with BioNumerics 6.0.Results The serotypes of the 28 Salmonella strains were 15 Salmonella enteritidis,4 Salmonella indiana,2 Salmonella Cholerae-Suis,2 Arizona,and 5 undetermined serotype.Based on PFGE results,the 28 strains were clasified into 4 major types,including 14 strains of type 1 with the similarity of more than 87.3%,7 strains of type 2(6 strains of 2A subtype with the similarity of more than 91.9%,one strain of 2B subtype with the similarity of more than 73.6%).Conclusion The main serotype of Salmonella isolated from food samples in Jilin province is Salmonella enteritidis.PFGE results show that the Salmonella strains of the same serotype are highly homologous.
Mechanism of apoptosis and its pathway induced by perfluorooctane sulfonate(PFOS) in murine glial cells
ZHANG Ling, JIANG Zhong-fa, ZHANG Ben-yan
2013, 29(2): 239-241. doi: 10.11847/zgggws2013-29-02-27
Abstract(1119) HTML (200) PDF 1048KB(54)
Abstract:
Objective To evaluate the apoptosis of murine microghia N9 cells related to mitochondrial function after PFOS exposure.Methods The N9 cells were exposed to PFOS at concentrations 5,10,50,100,and 200 μmol/L for 24 and 48 hours,respectively,and the controls were exposed to 0.5% dimethyl sulfoxide(DMSO).The apoptotic celluar ratio was detected by flow cytometry 24 hours after the exposure.Mitochondrial membrane potential(MMP) was measured by Rhodamine 123 and the expressions of p53,Bax,Bcl-2,caspase-3,and caspase-9 mRNA were detected by real-time (RT)-PCR after the exposure for 24 and 48 hours.β-actin was used as the internal reference gene.Results Compared with the apoptotic ratio(2.24%) of the control group,statistically significant increases in apoptotic celluar ratio were observed in 50,100,and 200 μmol/L PFOS exposure groups(20.81%,33.26%,and 48.72%).The dissipation of MMP was observed with punctate perinuclear fluorescence after 200 μmol/L PFOS exposure.But no dose-dependent up-regulation of p53,Bax,caspase-3,and caspase-9 mRNAs,and down-regulation of Bcl-2 mRNA were involved after PFOS exposure.Conclusion The results suggest that cell apoptosis induced by PFOS is mainly mediated by mitochrondrial pathway,in which PFOS could disturb homeostasis of microglial cells,impact mitochondria,and affect gene expression of apoptotic regulators.
Effect of different incubation time on formation of Escherichia coli biofilm
REN Wei, HUANG Xi, SHI Cai-xiao.et al
2013, 29(2): 242-244. doi: 10.11847/zgggws2013-29-02-28
Abstract(1115) HTML (126)
Abstract:
Objective To establish a closed continuous circulatory incubation system to prepare Escherichia coli(E coli) biofilm for investigating the effect of different incubation time on biofilm formation.Methods The bacteria within biofilm was assessed by counting adherent bacteria and the biofilm was assessed by scanning electron microscopy on the 5th,7th,and 10th day of the cutlure.Results On the 5th,7th,and 10th day,the viable bacterial counts(lg CFU/cm2) within the biofilm adhering to the internal surface of Teflon tube were 4.98?0.47,4.82?0.46,and 4.43?0.52,respectively.The viable bacterial counts were significantly different among the three groups(P<0.05).Bacterial colony count on the 10th day within the biofilm was significantly less than that on the 5th and 7th day(P<0.05).There was no difference between the bacterial colony count on the 5th and 7th day(P>0.05).The observation with scanning electron microscope showed that a large number of bacteria closely adhered to the Teflon tube'internal surface with extracellular polymeric substance(EPS) crossing network-like shape after continuous perfusion for 5 days.EPS adhered to single cell forming microcolony after continuous perfusion for 7 days.The stable mature biofilm formed on the internal surface of Teflon tube after continuous perfusion for 10 days.Conclusion Biofilm formation of E coli on the internal surface of Teflon tube is closely related to incubation time.With the increase of incubation time,the bacteria within biofilm gradually decreased and a mature and stable biofilm formed.
Two-week morbidity rate and medical service use among community residents in Tianjin
GU Li-li, SONG Chun-hua, LI Chang-ping.et al
2013, 29(2): 245-248. doi: 10.11847/zgggws2013-29-02-29
Abstract(1185) HTML (133) PDF 947KB(51)
Abstract:
Objective To examine two-week morbidity rate and medical service use among community residents in Tianjin and to provide reference for allocating health resources and offering medical services effectively.Methods Multistage cluster random sampling was adopted to obtain the sample population.We collected data by means of face-to-face questionnaire survey and physical examination.Results The two-week morbidity rate of the community residents was 33.21%(31.87% for male,34.45% for female).The top five diseases with higher two-week morbidity rate were hypertension,diabetes,coronary heart disease,upper respiratory illness,and cerebrovascular disease with slight difference compared to the results of the 4th survey on the medical service in Tianjin in 2008.The ratio of sick persons seeking medical service in two weeks was 85.00%.The three main reasons for the sick persons did not seek medical service were self-rated alleviation of the disease,economic problem,and being busy.Conclusion The general health level of Tianjin community residents need to be enhanced and chronic diseases have become the key influencing factors to the community residents' health.Much more medical service is in demand among community residents.
Willingness to take circumcision among non-Muslim male drug users
HUANG Yong-di, YANG Lei, WANG Qian.et al
2013, 29(2): 248-250. doi: 10.11847/zgggws2013-29-02-30
Abstract(1205) HTML (109) PDF 941KB(49)
Abstract:
Objective To examine the willingness,knowledge,and attitude to male circumcision and factors affecting the willingness among non-Muslim male drug users in Xinjiang Uygur Autonomous Region.Methods A cross-sectional questionnaire survey was conducted from January to October 2010 in Urumqi.Results Among 350 representative samples of non-Muslim male drug users,55.1%(193) reported the willingness to take circumcision.The main reasons for the willingness were to improve genital hygiene,to prevent penile cancer,and to treat foreskin or phimosis.Multivariate analyses indicated that those with family member or friends circumcised(odds ratio=2.071,95% confidence intervale:1.043-4.110) and self-judgement of redundant prepuce or phimosis(OR=9.355,95%CI:4.607-18.993)were more likely to take circumcision.Conclusion More than half of non-Muslim male drug users are absolutely willing to take circumcision in the population of Urumqi but the knowledge about male circumcision for human immunodeficiency virus infection prevention should be improved.
HIV sentinel surveillance among female sex workers in Jingjiang city, 2006-2011
ZHU Zhong-kui, ZHANG Xiang, YU Ming-run.et al
2013, 29(2): 251-253. doi: 10.11847/zgggws2013-29-02-31
Abstract(1261) HTML (169) PDF 939KB(55)
Abstract:
Objective To analyze the time trend of behaviors change related to human immunodeficiency virus/acquired immunodeficiency syndrom(HIV/AIDS) epidemic and to provide basis for comprehensive HIV infection prevention among female sex workers(FSWs).Methods From 2006 through 2011,continuous cross-sectional surveys were conducted among FSWs in communities recruited at entertainment places and in street.Approximate 400 blood samples were collected each year to test for HIV infection and syphilis.Results A total of 2 407 eligible FSWs completed questionnaires and blood tests.The prevalence of HIV infection and syphilis was 0-0.2% and 0-4.5%,respectively.Among the FSWs,71.8%-86.3% used condom all the time in commercial sex during the latest month.The awareness rate of HIV/AIDS transmission in the FSWs was 89.2%-94.3%.The proporton of the FSWs with drug use history was 0.2%-7.7% and the proportion was increasing(Z=6.65,P<0.000 1).There were 64.3%-96.8% and 30.6%-74.1% of the FSWs attending HIV testing and intervention services in the latest year,respectively,and the proportions showed a increasing trend.Conclusion Condom use rate needs to be enhanced among FSWs.HIV prevalence rate among FSWs in Jingjiang city is generally low,but high risk behaviors are still prevalent.More comprehensive and effective prevention measures and intervention should be promoted.
Prevalence of hypertension in Miao and Han ethnic groups and its relationship with metabolism syndrome
PAN Xing-shou, LI Tian-zi, LIANG Ye.et al
2013, 29(2): 253-256. doi: 10.11847/zgggws2013-29-02-32
Abstract(1321) HTML (220)
Abstract:
Objective To expore the characteristics of hypertension in Miao and Han ethnic groups and its relationship with metabolism syndrome(MS).Methods Totally 1 102 inhabitants in Longlin county of Guangxi were selected and their height,weight,blood pressure,fasting blood-sugar(FBS),and blood fat were measured and compared to those of 2 068 Han inhabitants.Results Among the Miao people,the morbidity of hypertension was 15.06%(18.75% for male,8.94% for female) and that of among the Han was 23.5%(27.36% for male,16.49% for female).The morbidity of Miao was lower than that in the Han(P<0.01),and that of the male was higher than the female(P<0.01).The morbidity of MS in the Miao people was 11.62%(13.66% for male,8.21% for female) and the morbidity in the Han was 17.55%(28.11% for male,11.99% for female).The morbidity of MS in the Miao was lower than in the Han and the(P<0.05) male had a higher morbidity than the female(P<0.01).Compared with Han people,the Miao people had lower obese rate,lower levels of total cholesterol,triglyceride,low-density lipoprotein cholesterol,and fasting blood sugar and also the lower knowledge and treatment rate of hypertension(P<0.01 for all).Conclusion The morbidity of hypertension and MS in Miao inhabitants are lower than those in local Han inhabitants,so as their risk factors of chronic vascular disease,and the knowledge and treatment rate of hypertension are also low in the Miao inbibitants.
Characteristics of sexual behavior and HIV infection among 1472 MSM with different gender role in Guangzhou city
DAI Li-ping, LIN Yu-xia, LIU Qi.et al
2013, 29(2): 256-258. doi: 10.11847/zgggws2013-29-02-33
Abstract(1164) HTML (121) PDF 940KB(84)
Abstract:
Objective To examine high risk behaviors and infection of human immunodeficiency virus(HIV) among men who have sex with men(MSM) in Guangzhou and to provide evidence for making effective intervention measures.Methods With cooperation of non-governmental organizations and network mobilization,a questionnaire survey and serological test were conducted among MSM taking voluntary consultation for AIDS/HIV infection.Results Totally 1 472 MSM with the average age of 28 years were surveyed.Among the MSM,40.70%(591/1 452) had 2 or more sexual partners during the previous 3 months and 69.16%(1 018/1 472) used condom when having every homosexual sex during the previous 1 month and 55.67%(712/1 279) during the previous 3 months.The infection rate of HIV and syphilis were 5.98%(88/1 472) and 4.08%(60/1 472) among the MSM.The receptive MSM had their first anal sex at younger age and had relative less number of sexual partners.The receptive MSM and the MSM with both receptive and insertive anal sex showed significantly lower rate of condom use and higher rate of HIV infection compared to insertive MSM.Conclusion The MSM in Guangzhou city had high prevalences of HIV infection,unsafe sexual behavior,and lower rate of condom use,and were the population at high risk of AIDS transmission with less self-protection.
Survey on commercial sex among men who have sex with men in Beijing with Simmons model
CHEN Xiang-yu, GAO Ge, YU Ming-run.et al
2013, 29(2): 259-260. doi: 10.11847/zgggws2013-29-02-34
Abstract(1245) HTML (113)
Abstract:
Objective To study the proportion of commercial sex among men who have sex with men(MSM) in Beijing and to provide basis for corresponding AIDS prevention and control program.Methods With stratified random sampling,Simmons model and the corresponding formulas were adopted to investigate the proportion of commercial sex among MSM in Beijing during July to December,2009.Results During the period,the estimated proportion of commercial sex among MSM in actual venues and internet in Beijing were 11.9% and 3.29%,respectively,and the overall rate was 5.11% with the 95% confidence limit of 0.017 to 0.085.The proportion of commercial sex event in actual venues was significantly higher than that finding partner through internet.Conclusion The proportion of finding commercial sex partner among MSM in actual venues is higher than that through the internet among the MSM in Beiing.
Prevalence of clonorchiasis in endemic areas of Liaoning province
LI Yan, TAO Yu-chun, TENG Cong.et al
2013, 29(2): 261-263. doi: 10.11847/zgggws2013-29-02-35
Abstract(1053) HTML (184)
Abstract:
Objective To explore the distribution and prevalent trend of clonorchiases and their influencing factors among residents living in endemic areas of Liaoning province for making effective measures to control the disease.Methods The stool specimens were collected among susceptible people in endemic areas of Liaoning province to assess infection of Clonorchis sinensis(C.sinensis) and monitoring on intermediate host of C.sinensis and a face-to-face questionnaine survey was also conducted simultaneously in May to October,2007.Chi-square test and Fisher's exact test were adopted in data analyses.Results The infection rate of C.sinesis was 3.48% among 1 754 residents participating in the survey and the infection rate was significantly different among the residents of different age(χ2=19.99,P=0.010),with the highest rate in the residents aged 71-81 years.There were significant differences in the infection rate among the residents of different nationality(χ2=24.85,P<0.001) and different education level(P<0.01).The highest infection rate of intermediate host was observed in Pseudorasbora parva(54.36%).The residents with different health behavior had different infection rate(P<0.001).Conclusion The results show that the infection rate of C.sinesis is closely related to age,nationality,and education level and Pseudorasbora elongate is the intermediate host with the highest infection rate in endemic areas of clonorchiasis in Liaoing province.
Descriptive analysis of trends of malaria prevalence in China from 2006 to 2010
LI Ya-nan, WEN Liang, LI Cheng-yi.et al
2013, 29(2): 263-265. doi: 10.11847/zgggws2013-29-02-36
Abstract(1367) HTML (147) PDF 1035KB(81)
Abstract:
Objective To characterize the spatio-temporal trends of malaria epidemic in the whole country from 2006 to 2010.Methods Malaria case data were collected spatially at the level of province in the whole country from 2006 to 2010 through the National Disease Supervision Information Management System.Arc GIS 9.0 software was employed to build a malaria database with geographic information and descriptive analyses of spatio-temporal trends of the disease were made based on the strata of five years.Results The malaria incidence rate of the whole country from 2006 to 2010 lowered from 4.60/100 000 to 0.55/100 000,with an average annual incidence of 2.34/100 000.The top three regions reported higher incidence were Anhui, Yunnan,and Hainan province,with the average annual incidence of 27.29/100 000,23.28/100 000,and 11.73/100 000,respectively,and the total incident cases of the three province accounted for 77.48% of all cases in the country during the period.Toally 51 deaths of malaria cases were reported in Yunnan(41) and Sichuan(10) province,accounting for 77.48% of all deaths in the country during the period.Male,farmers,and the elders were the majority of the incident cases and more cases occurred during summer and autumn season.Conclusion The malaria prevalence decreased greatly from 2006 to 2010 in China,and Anhui,Yunnan,Hainan province and Huaihe River Basin zone are the key areas for malaria prevention and control.
Behavior and mental health among new junior middle school students
ZHAO Nian, XIANG Bing, PENG Jian.et al
2013, 29(2): 266-269. doi: 10.11847/zgggws2013-29-02-37
Abstract(1149) HTML (173)
Abstract:
Objective To investigate behavior and mental health among new junior middle school students in Wuhan.Methods Totally 605 junior middle school students in Wuhan were surveyed with Chinese Middle School Students Mental Health Scale(MSSMHS) and a self-designed personal behavior questionnaire.EpiData 3.0 was used to input the data.The data were analyzed with SPSS 17.0.Results The prevalence rate of positive psychological symptoms in the students was 40.7%.Five different types of behavioral problems were identified among the students.Age at first smoking attempt was positively correlated with anxiety,hostility,and psychological imbalance and frequency of fighting was positively correlated with anxiety,hostility,learning stress,maladjustment,and psychological imbalance among the students.The mental health factors were correlated positively with times of playing computer games and negatively with learning attitude.Negative learning attitude and suicidal behavior were risk factors of psychological problem.Conclusion There is a correlation between behavior and mental health and psychological intervention should be taken among new junior middle school students.
Relationship between internet addiction and sense of responsibility in middle school students
LI Zhen, WANG Ling-feng
2013, 29(2): 269-271. doi: 10.11847/zgggws2013-29-02-38
Abstract(1096) HTML (170)
Abstract:
Objective To investigate the relationship between internet addiction and the sense of responsibility in middle school students.Methods Using the adolescent pathological internet use scale(APIUS) and the sense of responsibility questionnaire for middle school students,a sample of 654 middle school students in Huzhou city of Zhejiang province were tested.Results The proportion of internet addiction disorder in the middle school students was 6.7%,and that of marginal internet addiction was 3.7%.The rate of internet addiction in high-school students(9.4%) was significantly higher than that in junior middle school students(3.8%).The rate of internet addiction in male students(6.9%) was significantly higher than that in females(1.2%) in junior middle schools,and the rate of internet addiction in male students(13.6%) was higher than that in the females(6.2%) in high-schools,with significant differences.The sense of responsibility of normal middle school students was higher than that of the students with internet addiction disorder or marginal internet addiction.The score of global responsibility,general task responsibility,general negligence responsibility,and the scores of factors of task responsibility and negligence responsibility were all significantly related inversely with the total average score of internet addiction(r=-0.140- -0.463).The scores of global responsibility,general task responsibility,general negligence responsibility,and the scores of task academic responsibility,task family responsibility,negligence academic responsibility,and negligence family responsibility could inversely predict the total average score of internet addiction(β'=-0.101- -0.299).Conclusion The internet addiction disorder of middle school students was related with their sense of responsibility.
Logistic regression analysis on influential factors of smoking behavior among urban residents in Lanzhou
LIU Peng, BAI Ya-na, HU Xiao-bin.et al
2013, 29(2): 272-274. doi: 10.11847/zgggws2013-29-02-39
Abstract(1445) HTML (166)
Abstract:
Objective To investigate influential factors of smoking behavior among urban residents in Lanzhou city and to provide reference for preventing urban residents from smoking.Methods With cluster sampling method,1 072 urban residents aged 15 years and over were selected from two communities of Lanzhou and investigated with a questionnaire.Logistic regression was used to analysze influential factors of smoking.Results The smoking rate among the residents was 34.14%(55.07% for male and 3.02% for female) and 24.72% of the residents smoked every day.The influencing factors of smoking in the residents were gender,whether paying attention to people smoking around,familial income of last year,and the awareness of tobacco advertisements in previous 6 months.Conclusion Male population is still the key group for tobacco control in Lanzhou city.We should strengthen the laws against smoking ads to carry out tobacco control intervention.
Nutrition status of vitamin A among residents in major cities of Fujian province
LIN Hong-lin, HUA Yong-you, YUAN Ping.et al
2013, 29(2): 274-276. doi: 10.11847/zgggws2013-29-02-40
Abstract(1324) HTML (190)
Abstract:
Objective To evaluate the nutrition status of vitamin A among the residents in major cities of Fujian province.Methods Blood samples were collected from the residents in Fuzhou and Xiamen city,which were the cities sampled for National Nutrition and Health Survey 2010.A total of 392 subjects were randomly selected according to sampling requirements for vitamin A determination.The serum retinol levels were determined with high performance liquid chromatography(HPLC) coupled with ultraviolate detector and quantified with internal standard method.Results There was gender difference(F=7.267,P=0.005) in serum vitamin A concentration but there was no significant difference in vitamin A concentration between the residents of Fuzhou and Xiamen(F=0.004,P=0.949).The vitamin A deficiency among the residents was 3.3%,and the marginal vitamin A deficiency was 14.3%.The prevalences of vitamin A deficiency and marginal vitamin A deficiency were decreased with age(χ2=18.90,P<0.001).There were no significant differences in the prevalence of vitamin A deficiency between the residents of different gender(χ2=1.99,P=0.37) and cities(χ2=2.15,P=0.34).Conclusion The vitamin A nutrition status in the residents of major cities in Fujian province is not optimistic and attention should be paid to the problem in the residents.The vitamin A deficiency and marginal vitamin A deficiency decreased with the increment of age in the residents.
Cognition on hepatitis C among medical staff and undergraduate medical students
HE Bao-chang, GAO Xiao-ye, HE Fei.et al
2013, 29(2): 277-279. doi: 10.11847/zgggws2013-29-02-41
Abstract(1210) HTML (178)
Abstract:
Objective To explore the cognition of hepatitis C among medical staff and undergraduate medical students and to provide evidence for hepatitis C control.Methods With cluster sampling method,337 medical workers and 343 undergraduate medical students were selected for a questionnaire survey.Results The response rate was 93.25%.There were 96.44% of the medical staff and 90.38% of the medical students being aware of hepatitis C,with a significant difference between the two groups.The general awareness of medical staff about the transmission of hepatitis C was 69.57% and that of the students was 66.86%,with no significant difference between medical staff and medical students.Conclusion Efforts should be made to promote the level of the cognition on hepatitis C among medical staff and students.
Solar ultraviolet exposure on horizontal and vertical plane in winter and summer in Shenyang
HU Li-wen, GAO Qian, OU-YANG Nan-ning.et al
2013, 29(2): 279-281. doi: 10.11847/zgggws2013-29-02-42
Abstract(1141) HTML (147)
Abstract:
Objective To study the difference in ultraviolet(UV) exposures on horizontal and vertical plane,and to analyze the effect of snow reflect on UV exposures on both planes.Methods The UV exposure values on the horizontal and vertical plane were measured in winter(before and after snowing) and summer days using solar-UV sensors in Shenyang,China(41?51'N,123?27'E).Results The horizontal UV exposure distribution showed bell-shaped curves in winter(both before and after snowing) as well as in summer,which was consistent with the results of previous studies.The cumulative dosage of a half hour reached the peak value at midday(15 kJ/m2 before snowing in winter,17 kJ/m2 after snowing in winter and 93 kJ/m2 in summer.Vertical UV exposure distribution also showed bell-shaped single peak curves in winter(both before and after snowing).However,the distribution in summer was significantly different,showing bimodal curves with the peak values of a half-hour cumulative dose at 7:30-8:00(11kJ/m2) in the morning and 15:00-15:30(12 kJ/m2) in the afternoon.On the first day after snowing,the UV was reflected strongly from the snow surface.The horizontal UV exposure slightly higher than that before snowing(an increase of approximately 13.9%),while the vertical UV exposure significantly higher than that before snowing(an increase of about 98%),and even higher than that in summer(an increase of about 61.7%).Conclusion At morning and evening time in summer and the time after snowing in winter,the protection of some human anatomic sites that approximate vertical plane,especially the eye,should not be ignored.
Mortality and disease burden of injury among children and adolescents in Fujian province,2008-2010
ZHU Han-song, HUANG Wen-long, WU Sheng-gen.et al
2013, 29(2): 282-285. doi: 10.11847/zgggws2013-29-02-43
Abstract(1161) HTML (204)
Abstract:
Objective To explore epidemiolgic features of injury death among children and adolescents in Fujian province,and to provide basis for injury control and prevention.Methods Injury mortality data reported by health institutions in Fujian province through the National Disease Surveillance System during 2008 to 2010 were collected and analyzed.Results The top 2 injury mortalities were traffic accident(1.72/100 000) and drowning(0.75/100 000).The injury mortality rates were 4.44/100 000 and 2.28/100 000 for males and females with a significant gender difference(χ2=69.43,P<0.05).The age groups with the top 2 injury mortality were 15-18 years(4.71/100 000) and 1-4 years(4.18/100 000).Standardized potential years of life lost(SPYLL) and standardized potential years of life lost rate(SPYLLR) of male and female in rural area(male:27 933 years and 3.40‰,female:12 623 years and 1.73‰) were higher than those of in town(male:19 301 years and 2.22‰,female:9 502 years and 1.23‰).Conclusion Traffic accidents,drowning and falls are important cause of injury death among children and adolescents,and strategies to control the injuries should be promoted.
Prevalence and risk factors of reduced renal function among physical examinees in Xuzhou city
ZHUO Lang, DONG Xin, YANG Ke.et al
2013, 29(2): 285-287. doi: 10.11847/zgggws2013-29-02-44
Abstract(1263) HTML (196)
Abstract:
Objective To explore the prevalence rate and risk factors of reduced renal function(RRF) by retrospective analysis on data from a physical examination sample in Xuzhou city for the prevention of the disorder.Methods Totally 77 355 physical emaminees were selected to estimate glomerular filtration rate(eGFR) by retrospective analysis from 2006-2009.Results The prevalence rate of RRF among the participants was 1.18% with a standardized rate of 1.30%(1.19% for male and 1.18% for female) and there was no significant gender difference in the rate(P>0.05).The prevalence rate of RRF for the participants of 20-,30-,40-,50-,60-,70- and ≥80 age groups was 0.10%,0.20%,0.52%,1.20%,3.30%,7.62%,and 11.58%,respectively,and there were significant differences among the age groups(P=0.000).The prevalence of RRF increased with the increment of age with an increase rate 1.85% per 10 years for the male and 2.18 for the female.The results of logistic regression showed that high plasma viscosity,proteinuria,red blood cell urine,white blood cell urine,high low density lipoprotein,high fasting blood glucose,high systolic blood pressure,and serumuric acid were independently associated with RRF.Conclusion The prevalence rate of RRF in Xuzhou is lower than that of other reports.High plasma viscosity,proteinuria,red blood cell urine,white blood cell urine,high low density lipoprotein,high fasting blood glucose,high systolic blood pressure,and serumuric acid are independently associated with RRF.
Influence of family environment on mental health in migrant children
BAI Chun-yu, ZHANG Di, GU Guo-jia.et al
2013, 29(2): 288-289. doi: 10.11847/zgggws2013-29-02-45
Abstract(1235) HTML (175)
Abstract:
Objective To examine the influence of family environment on mental health in migrant children.Methods With cluster sampling,858 migrant children from 4 schools in Shenyang city were surveyed with mental health test(MHT) and Family Enviroment Scale-Chinese Vesion(FES-CV) questionnaires.Results There were mental health problems in the migrant children.The study anxiety was the most prevalent with an incidence rate of 48.50%.There were differences in the family environment between healthy and unhealthy children.The cohesion and organization factor scores in unhealthy children(6.61?2.29,4.95?1.86) were significantly lower than those in the healthy children(7.16?1.92,5.31?1.76)(P<0.01).The conflict factor score in unhealthy children(3.06?2.46) was significantly higher than that in the healthy children(2.43?1.98)(P<0.01).There were no differences in the intellectual-cultural orientation factor scores between healthy and unhealthy children.The family environment was correlated with mental health status of the children(P<0.01).Conclusion There were mental health problems in migrant children.The study anxiety and self-blame tendency are major problems among the children.The family environment influence mental health status of the migrant children.
2013, 29(2): 290-293. doi: 10.11847/zgggws2013-29-02-46
Abstract(1077) HTML (122) PDF 1027KB(85)
Abstract:
2013, 29(2): 293-296. doi: 10.11847/zgggws2013-29-02-47
Abstract(1089) HTML (149) PDF 1192KB(56)
Abstract:
2013, 29(2): 297-298. doi: 10.11847/zgggws2013-29-02-48
Abstract(938) HTML (114) PDF 931KB(48)
Abstract:
2013, 29(2): 299-302. doi: 10.11847/zgggws2013-29-02-49
Abstract(1326) HTML (178) PDF 949KB(38)
Abstract:
2013, 29(2): 302-305. doi: 10.11847/zgggws2013-29-02-50
Abstract(1118) HTML (170) PDF 952KB(55)
Abstract:
2013, 29(2): 306-309. doi: 10.11847/zgggws2013-29-02-51
Abstract(1093) HTML (130) PDF 944KB(50)
Abstract:
2013, 29(2): 309-311. doi: 10.11847/zgggws2013-29-02-52
Abstract(881) HTML (160) PDF 934KB(43)
Abstract:
2013, 29(2): 311-312. doi: 10.11847/zgggws2013-29-02-53
Abstract(1145) HTML (152) PDF 896KB(55)
Abstract: