High-density expression of a phagemid for AFB1 mimotope
-
Abstract
Objective To construct a phagemid for aflatoxin B1(AFB1) mimotope with the characteristics of high-density expression and a completely exposed N terminal,and to provide a method for preparing an alternative to AFB1 artificial antigen.Methods We constructed a phasemid expressing AFB1 mimotope and enterokinase site;the expression of the phasemid was induced by isopropyl-β-d-thiogalactopyranoside(IPTG).After protein cleavaged by enterokinase,an antibody of AFB1 was used in enzyme-linked immunosorbent assay(ELISA) to detect the reactionogenicity of the mimotope.Results The results of plasmid restriction endonuclease cleavage,PCR amplification and sequencing were in good accordance with the synthetic sequence;the target sequence GACGACGACGACAAGCATCCTAGTGATCCGCGTCATGGG was inserted and the mimotope cleavaged by enterokinase could be recognized by the antibody of AFB1,with an absorbance value of up to 2.112.Conclusion A phasemid expressing AFB1 mimotope exposed to the amino terminal of pⅧ after enterokinase cleavage was successfully constructed.
-
-